| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.028110 |
| Chromosome: | chromosome 9 |
| Location: | 886548 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403400 | (1 of 3) PF13637//PF13920 - Ankyrin repeats (many copies) (Ank_4) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGAGGTGTGGGCGGCATCGGGCCGGCCCCTCTGGCAGCCATTGCGGC |
| Internal bar code: | TTTCATGCCCTATTATTATGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4240 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 74 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATACTCACCTGCACAGT |
| Suggested primer 2: | GCGTGTTAGCATTGCGCATA |