| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.028145 |
| Chromosome: | chromosome 16 |
| Location: | 2895118 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663250 | (1 of 781) IPR000104 - Antifreeze protein, type I | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCACAGGTCGGCGCTGCTCACCGCCACGCCGCACAACTACCTCCCGCT |
| Internal bar code: | TCTGTTGTGCTATGTGGCAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1942 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCCCTGCATGCATCATTC |
| Suggested primer 2: | CCGTGTTGCCGCAACTTTAA |