| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.028227 |
| Chromosome: | chromosome 12 |
| Location: | 5635418 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531500 | DRC3,FAP134 | (1 of 8) PF14580 - Leucine-rich repeat (LRR_9); Nexin-dynein regulatory complex 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTTTGCGTCTAGGGACTATCACGGCGTCTTGGTTATCGTCATGTGCG |
| Internal bar code: | TGAAAGGTCGCCAAGGAGGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5823 |
| LEAP-Seq percent confirming: | 99.187 |
| LEAP-Seq n confirming: | 122 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 123 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGGGATTGTGAGTGACGG |
| Suggested primer 2: | CACCCCTGTCCACACTTCTC |