| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.028260 |
| Chromosome: | chromosome 3 |
| Location: | 950367 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g146727 | GOX9 | Glyoxal oxidase 9; (1 of 2) IPR009880//IPR011043//IPR013783//IPR014756//IPR015202//IPR015916 - Glyoxal oxidase, N-terminal // Galactose oxidase/kelch, beta-propeller // Immunoglobulin-like fold // Immunoglobulin E-set // Domain of unknown function DUF1929 // Galactose oxidase, beta-propeller | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAAGACACCACCCAGTTACAACGTGACCATGGGCGGGTTGGCATGCGT |
| Internal bar code: | GAGTTTTAGGTCTGTACCTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4418 |
| LEAP-Seq percent confirming: | 99.0741 |
| LEAP-Seq n confirming: | 107 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 108 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCAACTGTTGAGAGCGT |
| Suggested primer 2: | CAAGGTGTTGATTGTGGGCG |