Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.028265 |
Chromosome: | chromosome 13 |
Location: | 3445495 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g587150 | HAT5 | (1 of 2) K11308 - histone acetyltransferase MYST1 [EC:2.3.1.48] (MYST1, MOF, KAT8); Histone acetyltransferase 5 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGGTCAAGCCTCCACCAATTGTGCCCCGCCATGCCCCGCCACGCGCCG |
Internal bar code: | GAAGCGGTTTTGACTGCAGAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2057 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCGGACTTTGTGGTCAAC |
Suggested primer 2: | CCCAGATGATCGAGTTCGGG |