| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.028273 |
| Chromosome: | chromosome 17 |
| Location: | 2710978 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g717300 | DSP | (1 of 3) K14165 - atypical dual specificity phosphatase [EC:3.1.3.16 3.1.3.48] (K14165); Dual-Specificity Protein Phosphatase | intron |
| lncRNA_TCONS_00243503 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCTGGCTGAATTGCCGACAAGCAATCCCCAGTAGCCAAGAGCCCACA |
| Internal bar code: | ATGTAAAATTTTGCGTGATGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2193 |
| LEAP-Seq percent confirming: | 86.0465 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGACTTAGCGCACGACTT |
| Suggested primer 2: | GTCACCTTTTGTGGCGTGTC |