| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.028306 |
| Chromosome: | chromosome 10 |
| Location: | 5356038 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456900 | FPN4 | (1 of 2) PTHR12103//PTHR12103:SF21 - CYTOSOLIC PURINE 5-NUCLEOTIDASE-RELATED // IMP-GMP SPECIFIC 5-NUCLEOTIDASE, PUTATIVE-RELATED; Purine 5'-nucleotidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACACACACGCGCTGCGCAACCCCGCCCTGGCGGCGGCCACGGGCGCG |
| Internal bar code: | GTTTACACTGTTACATGTAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1515 |
| LEAP-Seq percent confirming: | 63.6364 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGTTTGGGTGCAGAGGT |
| Suggested primer 2: | CGTGCAATAGCGAACTCAGC |