| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.028327 |
| Chromosome: | chromosome 8 |
| Location: | 1635072 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g365825 | (1 of 1) 1.14.99.42 - Zeaxanthin 7,8-dioxygenase / Zeaxanthin 7,8(7',8')-cleavage dioxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGGTTTGGTCGCTTTTGGGTGTATTCGCTCGATTACTTGGCCGCCAGG |
| Internal bar code: | GCTTTCGTAAGTCGCATCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTTGGTTTTGCGCCGTCG |
| Suggested primer 2: | TGGCGTGAATTTGGCTGTTG |