| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.028440 |
| Chromosome: | chromosome 10 |
| Location: | 449188 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g420800 | C1d-HC2,FAP46 | Flagellar central pair-associated protein 46; (1 of 1) PTHR15977//PTHR15977:SF16 - FAMILY NOT NAMED // E030019B06RIK PROTEIN | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGTCATGTCGCTCCAGGTGCGCGGGCCGCTGTCGCTGGAGGCAGCGGC |
| Internal bar code: | TCTGACGCTCACAAGAGCCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1268 |
| LEAP-Seq percent confirming: | 96.4286 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGGAAGGTGCGCATCTAC |
| Suggested primer 2: | TTAGCCAGTGATGCAAGGGG |