| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.028629 |
| Chromosome: | chromosome 2 |
| Location: | 7681150 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g147301 | (1 of 33) IPR013763 - Cyclin-like | intron | |
| lncRNA_TCONS_00136852 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTAGAGCTACCCGTCCTGCACACGTGCGCGCTGCCTGTCCTAGCCCG |
| Internal bar code: | AAATTATAAGGTCTTTGATGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2655 |
| LEAP-Seq percent confirming: | 98.3871 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGACGACAGCTTCACTCCC |
| Suggested primer 2: | AAATGTTGTTTCAGCCCCGC |