| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.028821 |
| Chromosome: | chromosome 17 |
| Location: | 5995161 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g742450 | GST15 | (1 of 6) K00799 - glutathione S-transferase (GST, gst); Similar to Glutathione S-Transferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCCAGCACCCTCCGTGGCAGCCTGTCATTCTACTTTCTAGATCTCGC |
| Internal bar code: | GAGCAGAATGAAGTCTAGACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1114 |
| LEAP-Seq percent confirming: | 5.26316 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTGGCGGTAACTTCCTCG |
| Suggested primer 2: | GCGATGACGACAGCACAATC |