| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.028826 |
| Chromosome: | chromosome 2 |
| Location: | 6201701 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g120301 | SELH,SELENOH,SELH1 | (1 of 133) IPR012336 - Thioredoxin-like fold; Selenoprotein H | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTCGCGTGGTGTGGTGGTGGGAAACCATGGTGCCACAACTTTGCCCC |
| Internal bar code: | GGGGTGTCAATGGTGTGTTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1407 |
| LEAP-Seq percent confirming: | 90.3226 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTATCTGCATGGCTCGACG |
| Suggested primer 2: | CAGCAGTGACACGAAGGTCT |