| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.028956 |
| Chromosome: | chromosome 12 |
| Location: | 5430933 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529550 | CALK1,CALK,ALK1 | Aurora-like kinase; (1 of 1) PF00069//PF07714//PF14531 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // Kinase-like (Kinase-like) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTAGCCCGCCGCCTCCACTCTTGCGCCCAGCGTTCGTAGGCAGCGGC |
| Internal bar code: | GTTCGCCCGTACGAGGAATTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5647 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGCATGAAGAATGGGCAT |
| Suggested primer 2: | AGTCCATTGCAATACCCGCA |