| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.029037 |
| Chromosome: | chromosome 11 |
| Location: | 3173546 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475850 | ZNJ1 | (1 of 1) PTHR15852:SF22 - PROTEIN SSU-2, ISOFORM B; DnaJ-like Zinc-finger protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGTTCAAGATGATGGAGCCATCCGAGCAACTGGGTCAGCTGCATCAGG |
| Internal bar code: | GGGTCGTCAATCTTGTCGGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3145 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTTTGACGATGAGGCGC |
| Suggested primer 2: | CTAGCCGCGCTTCATTCCTA |