| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.029038 |
| Chromosome: | chromosome 11 |
| Location: | 2007435 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467766 | (1 of 1) 6.5.1.3 - RNA ligase (ATP) / Ribonucleic ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATGACGGCAGAGGCCGCAGCAGGCCACAGCAGGCCAGGGCAAACACGC |
| Internal bar code: | GCTCAAGAGAGAGGGGAGTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1225 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTAAGTGTCTGCGTGCGA |
| Suggested primer 2: | CTTCACATGAGGCGCGATTG |