Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.029095 |
Chromosome: | chromosome 2 |
Location: | 843725 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g078858 | PSN1 | Presenilin protease; (1 of 1) K04505 - presenilin 1 (PSEN1, PS1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCCCGTGCGGCGGTTGCGAGCGAGTGTATGTGACCGCTCCTGTGGCC |
Internal bar code: | CGTATGTGCTTAAGTGCGTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2208 |
LEAP-Seq percent confirming: | 87.5 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTTAGGACAACGGCCTCT |
Suggested primer 2: | ACTGCCTATGGTCCAAGCAC |