| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.029107 |
| Chromosome: | chromosome 1 |
| Location: | 3635485 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g023650 | Probable amino acid/metabolite permease; (1 of 4) PTHR11785:SF367 - AMINO-ACID PERMEASE BAT1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCACGCACACGCACTCATTCTCTGTCATCCGAGCGACGCCAACGCAC |
| Internal bar code: | AGCGTCTTCGGGGAGGTCCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 198 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACACCTCCCCCAAATCTG |
| Suggested primer 2: | TCGTCATGCACAGCAGTCTT |