Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.029115 |
Chromosome: | chromosome 16 |
Location: | 3083130 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g664500 | ARL6,BBS3B,ARFA1aBBS3B,BBS3 | (1 of 2) K07951 - ADP-ribosylation factor-like protein 6 (ARL6, BBS3); Bardet-Biedl syndrome-3 associated protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCCCATACTCTGTACTCACCCCTTTTCCACTTCATCCACGGTGAATC |
Internal bar code: | TAGGCACTTGAACGCTTAAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1194 |
LEAP-Seq percent confirming: | 95.0 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATAGCGGAGGTACAGGGC |
Suggested primer 2: | CAACAACCCTGACAGCTTGC |