| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.029121 |
| Chromosome: | chromosome 13 |
| Location: | 2871822 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g583200 | NAT5 | N-acetyltransferase related to GCN5; (1 of 6) PF02656 - Domain of unknown function (DUF202) (DUF202) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAAGGTGGACGCAAAGGTCTATTTGGGTGAGTAGGTTTCAGCGCAAAA |
| Internal bar code: | CATGCGAATATACGGTTTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 194 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACACCTTGAATGCGCCACT |
| Suggested primer 2: | GAGGTAGAGGTCGGTCCACT |