| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.029284 |
| Chromosome: | chromosome 14 |
| Location: | 1311183 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616550 | CYG50 | (1 of 1) IPR000104//IPR001054//IPR006189//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // CHASE domain // Nucleotide cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCAGAGGAGTTTGACAGCGTCACCATTTTGTTCACGGACATTGTGGCC |
| Internal bar code: | CGTCTACACGTTGAATTCGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4833 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTAGATCCCCAGACCCAC |
| Suggested primer 2: | CCCAAACATGTAGGGCCCAT |