Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.029284 |
Chromosome: | chromosome 14 |
Location: | 1311188 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g616550 | CYG50 | (1 of 1) IPR000104//IPR001054//IPR006189//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // CHASE domain // Nucleotide cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACCCTACGAGTAATACCAACGAGCGAGGCCGGGCATTGCTGAGCTGTC |
Internal bar code: | GCGTTACATAGCATTGAATACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5970 |
LEAP-Seq percent confirming: | 96.6102 |
LEAP-Seq n confirming: | 57 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCAAACATGTAGGGCCCAT |
Suggested primer 2: | AGGTAGATCCCCAGACCCAC |