Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.029303 |
Chromosome: | chromosome 12 |
Location: | 2488392 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g507250 | (1 of 1) K18681 - DIS3-like exonuclease 1 (DIS3L) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCCTGCCTTTCGCGGTGCTCACACCCTTGTCGATATTGCTAATCGATA |
Internal bar code: | ATGCCTTCGGTAATTGAACAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 491 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATGCATGTACCCACCACC |
Suggested primer 2: | CGGTTTTGCAACTTCTGGGG |