Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.029383 |
Chromosome: | chromosome 1 |
Location: | 6769885 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g048400 | DZIP1L,DZP1 | DAZ interacting zinc finger protein 1; (1 of 1) K16470 - zinc finger protein DZIP1 (DZIP1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGTCACGTGGAGAGGTCTGAGTGCCGCTGGCGTCGCCCGGCCTGGAC |
Internal bar code: | ATTACTGGTGTGTAGACGCCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1318 |
LEAP-Seq percent confirming: | 90.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTTGGGGCTCACACCACAT |
Suggested primer 2: | TTACTCAACACCCGCACTCC |