| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.029444 |
| Chromosome: | chromosome 7 |
| Location: | 669155 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317250 | CHI5 | (1 of 2) K01183 - chitinase (E3.2.1.14); Chitinase-like hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACATGTCCACTCGCTCGCTCAGCGCGCACCTAAACCTCGAGCCCCACC |
| Internal bar code: | AGATAATAGGTCAGGATCTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2970 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 62 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGACTTGATTGCATGCGGA |
| Suggested primer 2: | GTAGGTCGCCTACGTCGAAG |