Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.029497 |
Chromosome: | chromosome 7 |
Location: | 3273583 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g334350 | (1 of 3) 2.7.1.39 - Homoserine kinase | intron | |
Cre07.g334400 | EXN10 | Exonuclease RNase T and DNA polymerase III; (1 of 1) PTHR30231 - DNA POLYMERASE III SUBUNIT EPSILON | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCAGTGATTCGCGATCCCGCAGCCGTAGACTGTGTTACTGCTGCTCC |
Internal bar code: | TAGTCCGTCCGTTTTGGGCTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2189 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACAGGCTGATACACACCGC |
Suggested primer 2: | GGTACGGTAGGCAGGGAATG |