| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.029545 |
| Chromosome: | chromosome 13 |
| Location: | 1117798 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g569350 | SNE16 | (1 of 1) PTHR10366//PTHR10366:SF267 - NAD DEPENDENT EPIMERASE/DEHYDRATASE // PROTEIN F13D11.4; NAD dependent epimerase/dehydratase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAACGCTGTTCCGCACACGTCTCCCCAAGCTGCTCCACGCCTTAATCCC |
| Internal bar code: | GACCAGACATAGCTACAGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 440 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTAGGTGTTACGTGGCAA |
| Suggested primer 2: | GGTCGTTGAAGTACGGGGTT |