| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.029614 |
| Chromosome: | chromosome 2 |
| Location: | 59079 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073400 | (1 of 1) K01410 - mitochondrial intermediate peptidase [EC:3.4.24.59] (MIPEP) | intron | |
| Cre02.g800148 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGGGATCAGCGGGCGGCCTTCATCAGGGCTGCGGCGCAGATTAAACA |
| Internal bar code: | GATCAAACCATCAGGATCAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3566 |
| LEAP-Seq percent confirming: | 79.5455 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGGCCACTATGCATTGT |
| Suggested primer 2: | GACGAGGACAAGCTGGACAA |