| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.029645 |
| Chromosome: | chromosome 2 |
| Location: | 6650290 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389950 | OAT1 | O-acetyltransferase-related protein; (1 of 1) 2.3.1.45 - N-acetylneuraminate 7-O(or 9-O)-acetyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTTCACGCACCCTCACCCGCGCGTTGCCTCCAACTCGCAACCCGCGCA |
| Internal bar code: | CCTGTCTTGGGAAGCCTGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1198 |
| LEAP-Seq percent confirming: | 96.9697 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTTGGCCATACAATCAG |
| Suggested primer 2: | CACATCTACTGCCTGCCCAA |