| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.029775 |
| Chromosome: | chromosome 1 |
| Location: | 4314237 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029350 | C1d-87,FAP297 | Flagellar central pair-associated protein 297; (1 of 1) IPR006885//IPR017986 - NADH dehydrogenase ubiquinone Fe-S protein 4, mitochondrial // WD40-repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATCTGCTCCCGCCCCCAGGTACAACGTGCTTGAGGAGAAGCCAGTTG |
| Internal bar code: | AGAGACTCACGTCTGCAGTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 177 |
| LEAP-Seq percent confirming: | 11.7647 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTTGGTTGCACGTTGCCT |
| Suggested primer 2: | GTGTGTCGCAGTGTGGTTTC |