Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.029823 |
Chromosome: | chromosome 12 |
Location: | 2154961 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g509500 | (1 of 1) IPR000595//IPR002048//IPR011992//IPR018490//IPR029530 - Cyclic nucleotide-binding domain // EF-hand domain // EF-hand domain pair // Cyclic nucleotide-binding-like // Cell division control protein 31 | 5'UTR_intron | |
Cre12.g509550 | PDE5 | (1 of 3) 3.1.4.17//3.1.4.53 - 3',5'-cyclic-nucleotide phosphodiesterase / Cyclic AMP phosphodiesterase // 3',5'-cyclic-AMP phosphodiesterase / cAMP-specific phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCCTTGTCGCCCTGGCGGAAGAACTCCTCCTCCAGACCGCTCACCCA |
Internal bar code: | GCGTACAGCCACTAGCGTTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1796 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGCCATATTCGCGTCCTAC |
Suggested primer 2: | AGCACCCGTCTCTTGTGAAG |