| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.029918 |
| Chromosome: | chromosome 17 |
| Location: | 6360252 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g743647 | (1 of 32) IPR029062 - Class I glutamine amidotransferase-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGCGGAGGGTGAGCAAGGGGCACGGGTGATGGCGCTGTGGCGGCGGT |
| Internal bar code: | TCTGCAGGGTAGGGTAGTCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 76.4706 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGTGTGCTCCTCTTCCC |
| Suggested primer 2: | GCCCTATCGATCGTGCAGAA |