| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.029995 |
| Chromosome: | chromosome 10 |
| Location: | 2670896 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g437350 | MCP12,MITC12 | Mitochondrial substrate carrier protein; (1 of 1) PF00153//PF13499 - Mitochondrial carrier protein (Mito_carr) // EF-hand domain pair (EF-hand_7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGCAGGCTGTGTGGTGAGCCGCGCACGGGCTAGCGGGAAGATGCCA |
| Internal bar code: | GATATTAATAGATTGGCCCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 971 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACCACACTCCCCTCCCTC |
| Suggested primer 2: | CACGTTTGCGCTGTTCAAGA |