| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.030060 |
| Chromosome: | chromosome 1 |
| Location: | 2173928 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012150 | FKB16-10,MSRA4 | Peptide methionine-S-sulfoxide reductase, msrA-type; (1 of 1) 1.8.4.11//5.2.1.8 - Peptide-methionine (S)-S-oxide reductase / Peptide methionine sulfoxide reductase // Peptidylprolyl isomerase / Rotamase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTCGTTTCAGCATAGTACGTTCAGTGGGCGGTCCCTTGCGGGGCGCT |
| Internal bar code: | ACAATATGGCGGAAGGGACTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1157 |
| LEAP-Seq percent confirming: | 1.5873 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 62 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCGCATACAAACACACAC |
| Suggested primer 2: | CAAAACCGCGCAAAACCAAC |