Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.030068 |
Chromosome: | chromosome 2 |
Location: | 1571785 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g084800 | SPO11A | (1 of 1) K10878 - meiotic recombination protein SPO11 (SPO11); meoisis-related DNA topoisomerase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCTAAGACACAAGCGCGCCGGGCTACTTTGGGGGCAGACATTCAGAGC |
Internal bar code: | ATACTAGGCTTTGCCGACGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 115 |
LEAP-Seq percent confirming: | 28.5714 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGACGCTCCACTACGGTAGT |
Suggested primer 2: | GCGAGGGATTTGCATTCGAC |