| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.030120 |
| Chromosome: | chromosome 7 |
| Location: | 1065863 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320000 | GT90-38,GT90F38 | GT90 family protein 38; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCTGGGAACAGCGCCTGTGCATAGAACAAATACAAGAGGGACCAATC |
| Internal bar code: | GTCTGCGCAAAGTGAAAGCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5204 |
| LEAP-Seq percent confirming: | 94.3089 |
| LEAP-Seq n confirming: | 116 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 123 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGTTCGTAACTCGCAGCA |
| Suggested primer 2: | GCGCCACGATGAGTTCAATC |