Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.030166 |
Chromosome: | chromosome 2 |
Location: | 4693702 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g108000 | (1 of 1) K16315 - serine/threonine-protein kinase haspin [EC:2.7.11.1] (GSG2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCCGAGTCCTCCTCAGCTGCTGTCGATGGCACCGGCGTCGTGTCCTC |
Internal bar code: | ACACGCTGAAGTACTCCAAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1988 |
LEAP-Seq percent confirming: | 91.4286 |
LEAP-Seq n confirming: | 32 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGACAGCCAAAGGAGGAGG |
Suggested primer 2: | GAAGTCCTCCTTGCCGTCAA |