Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.030170 |
Chromosome: | chromosome 11 |
Location: | 1526679 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g468700 | CPLD65,HCAR1 | 7-hydroxymethyl chlorophyll a reductase; (1 of 1) 1.17.7.2 - 7-hydroxymethyl chlorophyll a reductase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCAGTGCTTCCATACACGTCGAGTCATGCCCCCGCTGCCGTACAGGT |
Internal bar code: | TTAAGCAATCTTCTGGGCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 66 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTCTGACGCCTTACAGT |
Suggested primer 2: | CACAAGCAACACCCCACATG |