| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.030188 |
| Chromosome: | chromosome 9 |
| Location: | 3160112 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394399 | (1 of 1) K14767 - U3 small nucleolar RNA-associated protein 3 (UTP3, SAS10) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTAGTGAACAAACCCACCTTAGCTGTCGCGTAGAAGTCGTCTTCCTC |
| Internal bar code: | GATTCATGAGTCCATCGCCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 609 |
| LEAP-Seq percent confirming: | 96.2963 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACATGCCATCCTCCT |
| Suggested primer 2: | TCCAGAACTCCAGCGAACAC |