| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.030199 |
| Chromosome: | chromosome 4 |
| Location: | 2175358 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g220000 | (1 of 4) IPR000719//IPR001245//IPR002290//IPR011009 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCCGAGCCACCCCGGTAGGCGACGGGGGGAGCGAAACCTGGTCGTGA |
| Internal bar code: | AGGATCGGGAGGACAGTGTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2042 |
| LEAP-Seq percent confirming: | 90.4762 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGAGGACATGAAGGTGG |
| Suggested primer 2: | CCTGTGTGTGTGCATGTGTG |