| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.030243 |
| Chromosome: | chromosome 2 |
| Location: | 4252092 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g104550 | Paf1 complex subunit CDC73; (1 of 1) K15175 - parafibromin (CDC73) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTGCCCGGGGCGGAAATCAGGGGTGCTCGGCAACTCGTGTGCACACAC |
| Internal bar code: | AGAATACAGCAAGTTATAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1477 |
| LEAP-Seq percent confirming: | 73.0159 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACCTGAGGGCACAATGAT |
| Suggested primer 2: | CTGTCACCTCTGCAGACGAG |