| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.030387 |
| Chromosome: | chromosome 11 |
| Location: | 3447354 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477400 | CYG43 | (1 of 1) PF00072//PF00211//PF02518 - Response regulator receiver domain (Response_reg) // Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (HATPase_c); Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTCAGACCGAGACCCAGCTGCTCAGCGGGCGAGCCGGTCAGCGGCGA |
| Internal bar code: | ACGCTCTGGTTTTTGTCGCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 953 |
| LEAP-Seq percent confirming: | 97.2222 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGTGCATGTGGAAACGGC |
| Suggested primer 2: | ACAATCAACACACGCACAGC |