| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.030489 |
| Chromosome: | chromosome 3 |
| Location: | 7974432 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g202000 | KIN4B,KIN4-2 | Kinesin motor protein; (1 of 4) K10395 - kinesin family member 4/21/27 (KIF4_21_27) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTCGCCGGTTGCACTCGATGGTGGCCGGACGCCAGCCCTGGCGCGCC |
| Internal bar code: | TGTATAGTAACGCCACTCTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2339 |
| LEAP-Seq percent confirming: | 90.0 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGATGCGGCTGAAAATG |
| Suggested primer 2: | GATAGAGGCCTGAGACGTGC |