| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.030642 |
| Chromosome: | chromosome 4 |
| Location: | 3487575 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227900 | PF20 | WD-repeat protein of flagellum central pair; (1 of 6) IPR001680//IPR015943//IPR017986//IPR020472 - WD40 repeat // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain // G-protein beta WD-40 repeat | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATAGCATCTTCACAGGAGCCGCCGGGAACTCAAGGTCCGCGTACGGGT |
| Internal bar code: | TTCACCCTGCTCCTGCTAAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1494 |
| LEAP-Seq percent confirming: | 92.0 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACACACACAATCCCACAC |
| Suggested primer 2: | TGTGCCACATCTTCCAGGTC |