| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.030728 |
| Chromosome: | chromosome 13 |
| Location: | 1957140 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g576350 | PFP2 | Prefoldin-family protein; (1 of 1) K17560 - unconventional prefoldin RPB5 interactor 1 (URI1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGCGCACCTTGTCCGGCAGTCGCCCAAGCAGCTCCCGCACTCGCGCC |
| Internal bar code: | ACTCAACCGGATTTAAAACCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2205 |
| LEAP-Seq percent confirming: | 89.2857 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTACGGGTTGCGCATACAA |
| Suggested primer 2: | GGTAATGGTGAGGGTGGTGG |