| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.030800 |
| Chromosome: | chromosome 16 |
| Location: | 5868308 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679550 | FAP277 | Flagellar Associated Protein 277; (1 of 1) K13963 - serpin B (SERPINB) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGTACAAACCGACCAGTGAGTACGGCACCGTACGGCAGTGCGGGCATT |
| Internal bar code: | GGGGCGTACACCAAATGAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 998 |
| LEAP-Seq percent confirming: | 93.9394 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAAACTTTTTCTCCCGCA |
| Suggested primer 2: | ACGCAAAGACACACGTTTCG |