| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.030802 |
| Chromosome: | chromosome 3 |
| Location: | 5634271 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g186100 | (1 of 13) IPR005123//IPR006620 - Oxoglutarate/iron-dependent dioxygenase // Prolyl 4-hydroxylase, alpha subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTTGCCGGTAGTCCTCTGCGGACAGGGACCAGACGGCACGCAACACG |
| Internal bar code: | GACGGCGGTGGGATAATGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4348 |
| LEAP-Seq percent confirming: | 98.6111 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCATCGTGGATATGGTGA |
| Suggested primer 2: | TCCCAGTTCGTGTGCCATAC |