| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.030816 |
| Chromosome: | chromosome 6 |
| Location: | 3152631 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g275900 | HON2,HON3 | Histone H1; (1 of 3) K11275 - histone H1/5 (H1_5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACCCATCCTTTAAATTAAGTCGGCCGAGCCTATCGACCGACCTTGCCA |
| Internal bar code: | GTGACTAGCTATTGAGTGAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4111 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGCCAAAACGTTAACGCT |
| Suggested primer 2: | GGGCACAGCTTAGCAACCTA |