| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.030867 |
| Chromosome: | chromosome 3 |
| Location: | 8029826 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201550 | MMP20 | Matrix metalloproteinase; (1 of 1) IPR000095//IPR008752 - CRIB domain // Peptidase M11, gametolysin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCGCTAGTGAGTTGCGTGGGGAAAGCGAGATACGGTAGAGCGGGGGC |
| Internal bar code: | TCATGATAGCAGTAATTAGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3417 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGAGCAAGCTAAATCGGC |
| Suggested primer 2: | GTTCTTCTTTGCCTTGCCCG |