| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.030876 |
| Chromosome: | chromosome 10 |
| Location: | 3405243 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443950 | (1 of 2) PF04564//PF05049 - U-box domain (U-box) // Interferon-inducible GTPase (IIGP) (IIGP) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGACTTGCCAGGGGCCGGCACGACCGAGTGCCCCGCCGCGCAGTACT |
| Internal bar code: | GCGTTGGCACCACGGGGACCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2179 |
| LEAP-Seq percent confirming: | 80.9524 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGGAGCCTTTAGGTGGTG |
| Suggested primer 2: | AACTGCTCTCATGCGAACCA |