Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.030924 |
Chromosome: | chromosome 2 |
Location: | 6669653 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g387060 | (1 of 1) K08202 - MFS transporter, OCT family, solute carrier family 22 (organic cation transporter), member 4/5 (SLC22A4_5, OCTN) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCACACGCCCTGGCCTGCCCTGCATTGCCCTGTCCTGTCCTGTCCTG |
Internal bar code: | TGCAAGGCGGGCTGAGGCTAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3420 |
LEAP-Seq percent confirming: | 90.0 |
LEAP-Seq n confirming: | 45 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACCACCATCCACACGTA |
Suggested primer 2: | TCATCGGCAGCGGAGTATTC |